Coronaviruset i verden: Nyheter og diskusjon

[Theo343]

Som sagt, jeg er fullstendig klar over at den er verre i Kina, det jeg lurer på er om dette kan ha betydning i andre storbyer

Endret 9. februar 2020 av Theo343

[Camlon]

10 hours ago, Theo343 said:

Som sagt, jeg er fullstendig klar over at den er verre i Kina, det jeg lurer på er om dette kan ha betydning i andre storbyer

Jeg tror mangel på medisinsk hjelp er et mye større problem enn luftforurensing i Wuhan.

Det betyr at hvis Norge får bare noen få tilfeller så vil dødsraten være lav, men hvis en million nordmenn får viruset så kan flere titusen nordmenn dø.

[Theo343]

3 hours ago, Camlon said:

Jeg tror mangel på medisinsk hjelp er et mye større problem enn luftforurensing i Wuhan.

Det betyr at hvis Norge får bare noen få tilfeller så vil dødsraten være lav, men hvis en million nordmenn får viruset så kan flere titusen nordmenn dø.

Ikke uenig, men er det ikke slik at andre land sliter med å få tilgang på medisinene da det meste produseres i Kina? Det var noen oppslag tidlig om at Kina holdt igjen medisiner til egen bekjempelse av dette.

Endret 10. februar 2020 av Theo343

[Gjest Slettet+5132]

14 hours ago, Theo343 said:

Som sagt, jeg er fullstendig klar over at den er verre i Kina, det jeg lurer på er om dette kan ha betydning i andre storbyer

Jo, men Oslo er i denne sammenhengen ingen storby. 

Skal dog ikke se bort ifra at det blir like ille i byer i si India, hvis det sprer seg der.

[G]

16 hours ago, PingEnt said:

Ja 

Kort sagt: høy NO2- og PM2.5-konsentrasjon i luften hvor pasienten bodde korrelerte med innleggelse for lungebetennelse.

 

EDIT: finnes masse studier på dette en enkelt kan få med Google søk.

 

For å nevne noen:

 

Fra Korea

Og andre

WHO har også en fin oppsummering av hva uren luft fra husholdninger kan gjøre for økt forekomst av lungebetennelse.

Nå er jo mennesket dessverre litt høyt rangert på evolusjonsstigen. Så forutsetningen er noe svakerestilt sånn sett, mest sannsynlig.

Men, naturlig seleksjon på svak og sterk ville jo nødvendigvis påvirket de små dyrene som overlevde massive vulkanutbrudd og dertil luftforurensning fra slike en god del år etter "dinosaur-meteoritt"-utryddelsen. Kanskje Kina etter 1000 års forurensningspåtrykk - nei hey, vent litt - "Kina evolverer seg i staten" og blir en ny foregangsland. Trump blir gjenvalgt, og får sementert kullarbeidernes arbeidsrettigheter, slik at kommende presidenter ikke tør å stopp kullutvinning. USA blir det neste storforurensende landet? Dere ser hvilket tankespor det begynte med, at Kina i teorien kunne fått en veldig sterk evolusjonsmessig menneskerase, gitt at ikke menneskeheten tok livet av seg selv på forurensing, krig eller andre måter.

Men til topic:

Vi har en del luftforurensing og byer i vesten også. Selv i Norge så bor det ihvertfall noen folk i forurenset miljø. Selv om tallet blir mye mindre enn Kinas.

[G]

15 hours ago, PingEnt said:

Ikke i nærheten av luftkvaliteten i Kina. Selv nå, etter lang tid med bilforbud, er luftkvaliteten i Wuhan dårligere enn det dårligste den har vært i Oslo på lenge. 

Merket at jeg på helgetur til London på en 2 døgns overnatting kom til å finne sot på slimhinner i nese etter å ha sovet 2 døgn på hotellet. Regner faktisk med at dette var mest i fra biltrafikken i London, samt kanskje litt industri (men vet ikke hvor mye forurensende industri London sitter igjen med). De koksfyrer vel ikke husene sine lengre, eller?

Et papirlommetørkle røpte at faren er overhengende stor i London når en kan se slik etter kun 2 overnattinger.

Lokasjon kan ha hatt noe å si, men vet ikke om det er av størst betydning, da det nok er mange soner som har nokså like forhold. Lær meg om London dersom så ikke skulle være tilfelle. Bodde noen få kvartaler fra denne stasjonen:

https://www.google.com/maps/place/Earl's+Court+Station/

 

Jeg har overnattet i en del andre byer før, og aldri opplevd noe så kraftig nedsoting av slimhinner.

Endret 10. februar 2020 av G

[Gjest Slettet+5132]

1 minute ago, G said:

Nå er jo mennesket dessverre litt høyt rangert på evolusjonsstigen. Så forutsetningen er noe svakerestilt sånn sett, mest sannsynlig.

Men, naturlig seleksjon på svak og sterk ville jo nødvendigvis påvirket de små dyrene som overlevde massive vulkanutbrudd og dertil luftforurensning fra slike en god del år etter "dinosaur-meteoritt"-utryddelsen. Kanskje Kina etter 1000 års forurensningspåtrykk - nei hey, vent litt - "Kina evolverer seg i staten" og blir en ny foregangsland. Trump blir gjenvalgt, og får sementert kullarbeidernes arbeidsrettigheter, slik at kommende presidenter ikke tør å stopp kullutvinning. USA blir det neste storforurensende landet? Dere ser hvilket tankespor det begynte med, at Kina i teorien kunne fått en veldig sterk evolusjonsmessig menneskerase, gitt at ikke menneskeheten tok livet av seg selv på forurensing, krig eller andre måter.

Men til topic:

Vi har en del luftforurensing og byer i vesten også. Selv i Norge så bor det ihvertfall noen folk i forurenset miljø. Selv om tallet blir mye mindre enn Kinas.

Evolusjon skjer på større tidshorisonter enn 1000 år. Dessuten er det mye som tilsier at det lille tidsspannet mennesker opplevde seriøs luftforurensing (1850 --) snart er forbi uansett. 

[Gjest Slettet+5132]

Just now, G said:

Merket at jeg på helgetur til London på en 2 døgns overnatting kom til å finne sot på slimhinner i nese etter å ha sovet 2 døgn på hotellet. Regner faktisk med at dette var mest i fra biltrafikken i London, samt kanskje litt industri (men vet ikke hvor mye forurensende industri London sitter igjen med). De koksfyrer vel ikke husene sine lengre, eller?

Et papirlommetørkle røpte at faren er overhengende stor i London når en kan se slik etter kun 2 overnattinger.

Jeg har overnattet i en del andre byer før, og aldri opplevd noe så kraftig nedsoting av slimhinner.

Jeg glemte at anekdoter var likestilt med statistikk. Men jo, London har også problemer, bare ikke like ille som i Kina.

[G]

14 hours ago, PingEnt said:

Det er en vesensforskjell. Kina har helseskadelig luft over lange perioder. Oslo har det er par dager i året. Studiene jeg viste til snakket om lengre eksponering til luftforurensning, ikke bare en dag eller to.

Man skal ikke kymse av luftforurensning, men den er markant verre i kinesiske storbyer. Det betyr ikke at man ikke skal gjøre noe med det i Oslo også, men det blir useriøst å sammenligne det med kinesiske tilstander.

Akkurat nå, kl. 1819 (0119 I Beijing) er luftkvaliteten i Beijing lista som "very unhealthy": http://aqicn.org/city/beijing/

Altså midt på natta er lufta så dårlig at den er skadelig selv for helt friske mennesker.

Tviler på at det blir min neste reisedestinasjon. Hvor mange mil utenfor må man hotellovernatte evt. for å komme ned på aksepable nivåer? 

[Theo343]

1 hour ago, PingEnt said:

Jo, men Oslo er i denne sammenhengen ingen storby. 

Skal dog ikke se bort ifra at det blir like ille i byer i si India, hvis det sprer seg der.

Enig der, Oslo er en liten drabantby i sammenligning. Men når luftkvaliteten forårsaker helseproblemer for utsatte grupper så er det likevel noe som må tas i betraktning (som det nok også gjøres, selv om graden er liten).

India har slitt en del med svineinfluensa en stund allerede og vil være veldig utsatt om også dette rammer dem. Det er en helt fersk og bra dokumentar på Netflix om dette som også gir innsyn i arbeid rundt en generell vaksine hvor man har som mål å beskytte mot alle HxNx strains samt fremtidige mutasjoner.

Ellers har SMOG i storbyer i Kina og andre regioner i bla. Sør-øst Asia vært et problem lenge. Men spesielt byer som Beijing er helt ekstreme.

Det samme gjelder regioner nord i Thailand hvor man fortsatt driver med en stor andel åpen søppelbrenning og annen forbrenning som skaper ekstremt dårlig luftkvalitet. I visse perioder av året rådes man generelt mot å reise til chiang mai pga. dette.

Dette er nok et generelt problem i store deler av Asia da luftkvalitet er jevnt over dårlig i byer og mengde forurensende partikler i luften er høy.

Jeg har brukt dette kartet i noen år når jeg har planlagt reiser til regionen og hvorvidt jeg skal nord eller sør etc.
https://www.airvisual.com/air-quality-map?lat=13.7292915&lng=100.4888394&zoomLevel=10

Denne viser det også i en globusvisning med luftstrømmer.
https://www.airvisual.com/earth?nav

I oslo har vi en hotspot i kirkeveien på 62, men selvsagt meget lavt ift. problemlandene.

Endret 10. februar 2020 av Theo343

[G]

Prosenten jeg har postet tidligere om har sunket til 20,8 % (død vs. overlevende, unntatt tot.)

Interessant å så hvor sårbare cruiseskipsreisende kan være. Ellers 9. februar første nye sak i London og Spania, og noen i Singapore og Malaysia.

Quote

February 10:

 

• 60 new cases in Japan on the “Diamond Princess” cruise ship. Total on ship quarantined in Japanese waters: 130 cases. Rest of Japan: 26 cases.
• 1 new case in Malaysia.

February 9:

 

•  With 910 deaths, the novel coronavirus (2019-nCoV) has now surpassed MERS (final toll of 858 deaths in 2012).
• 3 new cases in Singapore. Out of 43 cases: 6 critical in ICU, 6 discharged.
• 1 new case in the UK. First in London
• 1 new case in Spain
• The novel coronavirus had already overtaken the total case count of SARS (8,096 cases worldwide) on January 30.

 

Coronavirus Cases:

40,628

view by country

Deaths:

910

Recovered:

3,466

 

Endret 10. februar 2020 av G

[G]

57 minutes ago, Theo343 said:

Enig der, Oslo er en liten drabantby i sammenligning. Men når luftkvaliteten forårsaker helseproblemer for utsatte grupper så er det likevel noe som må tas i betraktning (som det nok også gjøres, selv om graden er liten).

India har slitt en del med svineinfluensa en stund allerede og vil være veldig utsatt om også dette rammer dem. Det er en helt fersk og bra dokumentar på Netflix om dette som også gir innsyn i arbeid rundt en generell vaksine som som har som mål å beskytte mot alle HxNx strains.

Ellers har SMOG i storbyer i Kina og andre regioner i bla. Sør-øst Asia vært et problem lenge. Men spesielt byer som Beijing er helt ekstreme.

Det samme gjelder regioner nord i Thailand hvor man fortsatt driver med en stor andel åpen søppelbrenning og annen forbrenning som skaper ekstremt dårlig luftkvalitet. I visse perioder av året rådes man generelt mot å reise til chiang mai pga. dette.

Dette er nok et generelt problem i store deler av Asia da luftkvalitet er jevnt over dårlig i byer og mengde forurensende partikler i luften er høy.

En skal faktisk ikke så mye lengre vest enn til f.eks. Toronto for å ta en by med stor smog-problematikk.

https://www.torontoenvironment.org/smog_facts

Quote

Air pollution affects the health of all Canadians, especially children, the elderly and those with respiratory and cardiac conditions.

In 2004, Toronto Public Health estimated that 1,700 Toronto residents die prematurely each year due to air pollution (ground-level ozone, nitrogen dioxide, sulphur dioxide, carbon monoxide, particulate matter and sulphates). Another 6,000 Toronto residents are admitted to hospitals due to air pollution. By 2014, thankfully, the numbers had gone down. Premature deaths are now estimated at 1,300 per year and hospitalizations are estimated at 3,550 per year.

 

Endret 10. februar 2020 av G

[Oddvardm]

Kan jeg spørre om hva det er som dreper pasientene? Er det imunforsvaret som går amok og dreper friskt vev, eller er det lungebetennelse med komplikasjoner som er 'killeren'?

[G]

11 minutes ago, Oddvardm said:

Kan jeg spørre om hva det er som dreper pasientene? Er det imunforsvaret som går amok og dreper friskt vev, eller er det lungebetennelse med komplikasjoner som er 'killeren'?

Har for lite greie på det. Men tipper at selve viruset kan drepe, at opportunistiske bakterielle infeksjoner kan drepe. Immunforsvaret overreagerer og bidrar til å gjøre overlevelsesmuligheten mye dårligere?

Det er ihvertfall rapportert at folk som har overlevd viruset like etterpå rammes av en bakteriell infeksjon og dør av den.

 

Nå har FHI fått fingeren ut og kokt i hop sine anbefalte føringer:

https://fhi.no/sv/smittsomme-sykdommer/corona/meldinger/samling-av-artikler-om-nytt-kronavirus-i-en-artikkel/

Quote

Råd etter reisen
Personer som utvikler tegn på luftveisinfeksjon i løpet av de første 14 dagene etter hjemkomst fra områder med vedvarende smittespredning, bør kontakte lege med tanke på koronavirus. Tegn på luftveisinfeksjon kan være feber, hoste, brystsmerter, pustevansker. Informer legen om hvor og når du har vært på reise.

Burde ikke dette strengt tatt som et minimum også inkludere om du har vært innom storflyplasser og nesten hvilke som helst type storbyer også da? Burde ikke mistanke om smitte være det vesentlige her? Teksten virker så passiviserende og tafatt. Men helsevesenet har kanskje ikke ressurser, eller vil ikke bruke mer ressurser på dette?

Endret 10. februar 2020 av G

[Simen1]

G: Du regner akkumulert overlevelsesrate hver gang. Kan du regne overlevelsesrate for kun siste døgn? Altså hvor mange døde vs hvor mange overlevende siste døgn? Siden den øker så må det jo bety at overlevelseraten de siste døgnene trekker akkumulert overlevelserate kraftig opp.

Altså: Hvor er overlevelseraten på vei nå som de har fått mer erfaring med sykdommen? Hvilken overlevelserate kan vi forvente oss i Norge hvis det sprer seg her?

[G]

Det virker ikke som om at overlevelserate er så lett å finne serverte tall på. Da måtte en ha fulgt med kanskje hver dag, dersom noen ikke vet om riktig side for overlevelsesrate da å komme med da? De tallene jeg viste var jo bare tatt nå og da. Og jeg ser nå i etterkant at f.eks. dagens serverte tall på 21 % faktisk ligger på siden der, om jeg bare hadde lett bedre.

WHO ble ihvertfall tatt på senga forteller disse tallene, til og med synsing av trender hadde vært lite vits, da siden det er hentet fra er overlegent på det også:

Quote

How contagious is the Wuhan Coronavirus? (Ro)
The attack rate or transmissibility (how rapidly the disease spreads) of a virus is indicated by its reproductive number (Ro, pronounced R-nought or r-zero), which represents the average number of people who will catch the disease from a single infected person.

A more recent study is indicating a Ro as high as 4.08.[22]. This value substantially exceeds WHO's estimate (made on Jan. 23) of between 1.4 and 2.5[13], and is also higher than recent estimates between 3.6 and 4.0 and between 2.24 to 3.58 [23]. Preliminary studies had estimated Ro to be between 1.5 and 3.5 [5][6][7]

Based on these numbers, on average every case of the Novel Coronavirus would create 3 to 4 new cases.

An outbreak with a reproductive number of below 1 will gradually disappear.

For comparison, the Ro for the common flu is 1.3 and for SARS it was 2.0.

 

Death Toll and Trends:

https://www.worldometers.info/coronavirus/coronavirus-death-toll/

 

Corona Virus cases:

https://www.worldometers.info/coronavirus/coronavirus-cases/

 

Andre perspektiv:

Quote

‘I’m So Sorry’: Coronavirus Survivor’s Cross-China Travel Left Dozens Quarantined
More than 40 people were quarantined after 32-year-old architect who passed through Wuhan fell sick

https://www.wsj.com/articles/a-virus-survivors-tale-of-crossing-china-in-the-early-days-of-outbreak-11581245096

Endret 10. februar 2020 av G

[G]

Kanskje ikke så overraskende. Men smitte på selve sykehuset er en faktor som var rimelig stor for data hentet inn til 3. februar:

Utdrag:

Quote

Findings In this single-center case series involving 138 patients with NCIP, 26% of patients required admission to the intensive care unit and 4.3% died. Presumed human-to-human hospital-associated transmission of 2019-nCoV was suspected in 41% of patients.

Spoiler

Original Investigation 

Caring for the Critically Ill Patient

February 7, 2020

Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus–Infected Pneumonia in Wuhan, China

Dawei Wang, MD¹; Bo Hu, MD¹; Chang Hu, MD¹; et alFangfang Zhu, MD¹; Xing Liu, MD¹; Jing Zhang, MD¹; Binbin Wang, MD¹; Hui Xiang, MD¹; Zhenshun Cheng, MD²; Yong Xiong, MD³; Yan Zhao, MD⁴; Yirong Li, MD⁵; Xinghuan Wang, MD⁶; Zhiyong Peng, MD¹

Author Affiliations Article Information

JAMA. Published online February 7, 2020. doi:10.1001/jama.2020.1585

Coronavirus Resource Center

related articles icon 

Related

Articles

•  
   
   
•  
   
   
•  
   
   
•  
   
   

 

Key Points

Question  What are the clinical characteristics of hospitalized patients with 2019 novel coronavirus (2019-nCoV)–infected pneumonia (NCIP) in Wuhan, China?

Findings  In this single-center case series involving 138 patients with NCIP, 26% of patients required admission to the intensive care unit and 4.3% died. Presumed human-to-human hospital-associated transmission of 2019-nCoV was suspected in 41% of patients.

Meaning  In this case series in Wuhan, China, NCIP was frequently associated with presumed hospital-related transmission, 26% of patients required intensive care unit treatment, and mortality was 4.3%.

Abstract

Importance  In December 2019, novel coronavirus (2019-nCoV)–infected pneumonia (NCIP) occurred in Wuhan, China. The number of cases has increased rapidly but information on the clinical characteristics of affected patients is limited.

Objective  To describe the epidemiological and clinical characteristics of NCIP.

Design, Setting, and Participants  Retrospective, single-center case series of the 138 consecutive hospitalized patients with confirmed NCIP at Zhongnan Hospital of Wuhan University in Wuhan, China, from January 1 to January 28, 2020; final date of follow-up was February 3, 2020.

Exposures  Documented NCIP.

Main Outcomes and Measures  Epidemiological, demographic, clinical, laboratory, radiological, and treatment data were collected and analyzed. Outcomes of critically ill patients and noncritically ill patients were compared. Presumed hospital-related transmission was suspected if a cluster of health professionals or hospitalized patients in the same wards became infected and a possible source of infection could be tracked.

Results  Of 138 hospitalized patients with NCIP, the median age was 56 years (interquartile range, 42-68; range, 22-92 years) and 75 (54.3%) were men. Hospital-associated transmission was suspected as the presumed mechanism of infection for affected health professionals (40 [29%]) and hospitalized patients (17 [12.3%]). Common symptoms included fever (136 [98.6%]), fatigue (96 [69.6%]), and dry cough (82 [59.4%]). Lymphopenia (lymphocyte count, 0.8 × 10⁹/L [interquartile range {IQR}, 0.6-1.1]) occurred in 97 patients (70.3%), prolonged prothrombin time (13.0 seconds [IQR, 12.3-13.7]) in 80 patients (58%), and elevated lactate dehydrogenase (261 U/L [IQR, 182-403]) in 55 patients (39.9%). Chest computed tomographic scans showed bilateral patchy shadows or ground glass opacity in the lungs of all patients. Most patients received antiviral therapy (oseltamivir, 124 [89.9%]), and many received antibacterial therapy (moxifloxacin, 89 [64.4%]; ceftriaxone, 34 [24.6%]; azithromycin, 25 [18.1%]) and glucocorticoid therapy (62 [44.9%]). Thirty-six patients (26.1%) were transferred to the intensive care unit (ICU) because of complications, including acute respiratory distress syndrome (22 [61.1%]), arrhythmia (16 [44.4%]), and shock (11 [30.6%]). The median time from first symptom to dyspnea was 5.0 days, to hospital admission was 7.0 days, and to ARDS was 8.0 days. Patients treated in the ICU (n = 36), compared with patients not treated in the ICU (n = 102), were older (median age, 66 years vs 51 years), were more likely to have underlying comorbidities (26 [72.2%] vs 38 [37.3%]), and were more likely to have dyspnea (23 [63.9%] vs 20 [19.6%]), and anorexia (24 [66.7%] vs 31 [30.4%]). Of the 36 cases in the ICU, 4 (11.1%) received high-flow oxygen therapy, 15 (41.7%) received noninvasive ventilation, and 17 (47.2%) received invasive ventilation (4 were switched to extracorporeal membrane oxygenation). As of February 3, 47 patients (34.1%) were discharged and 6 died (overall mortality, 4.3%), but the remaining patients are still hospitalized. Among those discharged alive (n = 47), the median hospital stay was 10 days (IQR, 7.0-14.0).

Conclusions and Relevance  In this single-center case series of 138 hospitalized patients with confirmed NCIP in Wuhan, China, presumed hospital-related transmission of 2019-nCoV was suspected in 41% of patients, 26% of patients received ICU care, and mortality was 4.3%.

 

Introduction

In December 2019, a cluster of acute respiratory illness, now known as novel coronavirus–infected pneumonia (NCIP), occurred in Wuhan, Hubei Province, China.^1-5 The disease has rapidly spread from Wuhan to other areas. As of January 31, 2020, a total of 9692 NCIP cases in China have been confirmed. Internationally, cases have been reported in 24 countries and 5 continents.⁶ On January 3, 2020, the 2019 novel coronavirus (2019-nCoV) was identified in samples of bronchoalveolar lavage fluid from a patient in Wuhan and was confirmed as the cause of the NCIP.⁷ Full-genome sequencing and phylogenic analysis indicated that 2019-nCoV is a distinct clade from the betacoronaviruses associated with human severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS).⁷ The 2019-nCoV has features typical of the coronavirus family and was classified in the betacoronavirus 2b lineage. The 2019-nCoV has close similarity to bat coronaviruses, and it has been postulated that bats are the primary source. While the origin of the 2019-nCoV is still being investigated, current evidence suggests spread to humans occurred via transmission from wild animals illegally sold in the Huanan Seafood Wholesale Market.⁸

Huang et al⁹ first reported 41 cases of NCIP in which most patients had a history of exposure to Huanan Seafood Wholesale Market. Patients’ clinical manifestations included fever, nonproductive cough, dyspnea, myalgia, fatigue, normal or decreased leukocyte counts, and radiographic evidence of pneumonia. Organ dysfunction (eg, shock, acute respiratory distress syndrome [ARDS], acute cardiac injury, and acute kidney injury) and death can occur in severe cases.⁹ Subsequently, Chen et al⁸ reported findings from 99 cases of NCIP from the same hospital and the results suggested that the 2019-nCoV infection clustered within groups of humans in close contact, was more likely to affect older men with comorbidities, and could result in ARDS. However, the difference in clinical characteristics between severe and nonsevere cases was not reported. Case reports confirmed human-to-human transmission of NCIP.^10,11 At present, there are no effective therapies or vaccines for NCIP. The objective of this case series was to describe the clinical characteristics of 138 hospitalized patients with NCIP and to compare severe cases who received intensive care unit (ICU) care with nonsevere cases who did not receive ICU care.

Methods

Study Design and Participants

This case series was approved by the institutional ethics board of Zhongnan Hospital of Wuhan University (No. 2020020). All consecutive patients with confirmed NCIP admitted to Zhongnan Hospital of Wuhan University from January 1 to January 28, 2020, were enrolled. Oral consent was obtained from patients. Zhongnan Hospital, located in Wuhan, Hubei Province, the endemic areas of NCIP, is one of the major tertiary teaching hospitals and is responsible for the treatments for NCIP assigned by the government. All patients with NCIP enrolled in this study were diagnosed according to World Health Organization interim guidance.¹² The clinical outcomes (ie, discharges, mortality, length of stay) were monitored up to February 3, 2020, the final date of follow-up.

Data Collection

The medical records of patients were analyzed by the research team of the Department of Critical Care Medicine, Zhongnan Hospital of Wuhan University. Epidemiological, clinical, laboratory, and radiological characteristics and treatment and outcomes data were obtained with data collection forms from electronic medical records. The data were reviewed by a trained team of physicians. Information recorded included demographic data, medical history, exposure history, underlying comorbidities, symptoms, signs, laboratory findings, chest computed tomographic (CT) scans, and treatment measures (ie, antiviral therapy, corticosteroid therapy, respiratory support, kidney replacement therapy). The date of disease onset was defined as the day when the symptom was noticed. Symptoms, signs, laboratory values, chest CT scan, and treatment measures during the hospital stay were collected. ARDS was defined according to the Berlin definition.¹³ Acute kidney injury was identified according to the Kidney Disease: Improving Global Outcomes definition.¹⁴ Cardiac injury was defined if the serum levels of cardiac biomarkers (eg, troponin I) were above the 99th percentile upper reference limit or new abnormalities were shown in electrocardiography and echocardiography.⁹ For patients admitted to the ICU, the Glasgow Coma Scale, Sequential Organ Failure Assessment, and Acute Physiology and Chronic Health Evaluation II scores were determined on the day of ICU admission. The durations from onset of disease to hospital admission, dyspnea, ARDS, and ICU admission were recorded.

Presumed hospital-related transmission was suspected if a cluster of medical professionals or hospitalized patients in the same wards became infected in a certain time period and a possible source of infection could be tracked.

Real-Time Reverse Transcription Polymerase Chain Reaction Assay for nCoV

Throat swab samples were collected for extracting 2019-nCoV RNA from patients suspected of having 2019-nCoV infection. After collection, the throat swabs were placed into a collection tube with 150 μL of virus preservation solution, and total RNA was extracted within 2 hours using the respiratory sample RNA isolation kit (Zhongzhi, Wuhan, China). In brief, 40 μL of cell lysates were transferred into a collection tube followed by vortex for 10 seconds. After standing at room temperature for 10 minutes, the collection tube was centrifugated at 1000 rpm/min for 5 minutes. The suspension was used for real-time reverse transcription polymerase chain reaction (RT-PCR) assay of 2019-nCoV RNA. Two target genes, including open reading frame 1ab (ORF1ab) and nucleocapsid protein (N), were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (ORF1ab? forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. Target 2 (N): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; and the probe 5′-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3′. The real-time RT-PCR assay was performed using a 2019-nCoV nucleic acid detection kit according to the manufacturer’s protocol (Shanghai bio-germ Medical Technology Co Ltd). Reaction mixture contains 12 μL of reaction buffer, 4 μL of enzyme solution, 4 μL of Probe primers solution, 3 μL of diethyl pyrocarbonate–treated water, and 2 μL of RNA template. RT-PCR assay was performed under the following conditions: incubation at 50 °C for 15 minutes and 95 °C for 5 minutes, 40 cycles of denaturation at 94 °C for 15 seconds, and extending and collecting fluorescence signal at 55 °C for 45 seconds. A cycle threshold value (Ct-value) less than 37 was defined as a positive test result, and a Ct-value of 40 or more was defined as a negative test. These diagnostic criteria were based on the recommendation by the National Institute for Viral Disease Control and Prevention (China) (http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). A medium load, defined as a Ct-value of 37 to less than 40, required confirmation by retesting.

Statistical Analysis

Categorical variables were described as frequency rates and percentages, and continuous variables were described using mean, median, and interquartile range (IQR) values. Means for continuous variables were compared using independent group t tests when the data were normally distributed; otherwise, the Mann-Whitney test was used. Data (nonnormal distribution) from repeated measures were compared using the generalized linear mixed model. Proportions for categorical variables were compared using the χ² test, although the Fisher exact test was used when the data were limited. All statistical analyses were performed using SPSS (Statistical Package for the Social Sciences) version 13.0 software (SPSS Inc). For unadjusted comparisons, a 2-sided α of less than .05 was considered statistically significant. The analyses have not been adjusted for multiple comparisons and, given the potential for type I error, the findings should be interpreted as exploratory and descriptive.

Results

Presenting Characteristics

The study population included 138 hospitalized patients with confirmed NCIP. The median age was 56 years (IQR, 42-68; range, 22-92 years), and 75 (54.3%) were men. Of these patients, 102 (73.9%) were admitted to isolation wards, and 36 (26.1%) were admitted and transferred to the ICU because of the development of organ dysfunction (Table 1). The median durations from first symptoms to dyspnea, hospital admission, and ARDS were 5 days (IQR, 1-10), 7 days (IQR, 4-8), and 8 days (IQR, 6-12), respectively (Table 1). Of the 138 patients, 64 (46.4%) had 1 or more coexisting medical conditions. Hypertension (43 [31.2%]), diabetes (14 [10.1%]), cardiovascular disease (20 [14.5%]), and malignancy (10 [7.2%]) were the most common coexisting conditions.

The most common symptoms at onset of illness were fever (136 [98.6%]), fatigue (96 [69.6%]), dry cough (82 [59.4%]), myalgia (48 [34.8%]), and dyspnea (43 [31.2%]). Less common symptoms were headache, dizziness, abdominal pain, diarrhea, nausea, and vomiting (Table 1). A total of 14 patients (10.1%) initially presented with diarrhea and nausea 1 to 2 days prior to development of fever and dyspnea.

Compared with patients who did not receive ICU care (n = 102), patients who required ICU care (n = 36) were significantly older (median age, 66 years [IQR, 57-78] vs 51 years [IQR, 37-62]; P < .001) and were more likely to have underlying comorbidities, including hypertension (21 [58.3%] vs 22 [21.6%], diabetes (8 [22.2%] vs 6 [5.9%]), cardiovascular disease (9 [25.0%] vs 11 [10.8%]), and cerebrovascular disease (6 [16.7%] vs 1 [1.0%]). Compared with the non-ICU patients, patients admitted to the ICU were more likely to report pharyngeal pain, dyspnea, dizziness, abdominal pain, and anorexia.

Vital Signs and Laboratory Parameters in ICU and Non-ICU Patients

Heart rate, respiratory rate, and mean arterial pressure did not differ between patients who received ICU care and patients who did not receive ICU care. These measures were recorded on day of hospital admission for all patients, then divided into those who were later admitted to the ICU or not. There were numerous differences in laboratory findings between patients admitted to the ICU and those not admitted to the ICU (Table 2), including higher white blood cell and neutrophil counts, as well as higher levels of D-dimer, creatine kinase, and creatine. All of the 138 enrolled patients showed bilateral involvement of chest CT scan (Figure 1). The median time from onset of symptoms to ICU admission was 10 days (IQR, 6-12) (Table 3). On the day of ICU admission, the median Glasgow Coma Scale; Acute Physiology and Chronic Health Evaluation II; and Sequential Organ Failure Assessment scores were 15 (IQR, 9-15), 17 (IQR, 10-22), and 5 (IQR, 3-6), respectively (Table 3). The median partial pressure of oxygen level was 68 mm Hg (IQR, 56-89) and the median of partial pressure of oxygen to fraction of inspired oxygen ratio was 136 mm Hg (IQR, 103-234).

Organ Dysfunctions and Main Interventions

The organ dysfunction and treatment of the 138 patients are shown in Table 4. As of February 3, 2020, 85 patients (61.6%) were still hospitalized. A total of 47 patients (34.1%) had been discharged, and 6 patients (4.3%) had died. Of the 36 patients admitted to the ICU, 11 were still in the ICU, 9 had been discharged to home, 10 had been transferred to the general wards, and 6 had died. Of the 11 patients who remained in the ICU, 6 received invasive ventilation (1 switched to extracorporeal membrane oxygenation) and 5 to noninvasive ventilations). Common complications among the 138 patients included shock (12 [8.7%]), ARDS (27 [19.6%]), arrhythmia (23 [16.7%]), and acute cardiac injury (10 [7.2%]). Patients who received care in the ICU were more likely to have one of these complications than non-ICU patients.

Most patients received antiviral therapy (oseltamivir, 124 [89.9%]), and many received antibacterial therapy (moxifloxacin, 89 [64.4%]; ceftriaxone, 34 [24.6%]; azithromycin, 25 [18.1%]) and glucocorticoid therapy (62 [44.9%]). In the ICU, 4 patients (11.1%) received high-flow oxygen and 15 (44.4%) received noninvasive ventilation. Invasive mechanical ventilation was required in 17 patients (47.2%), 4 of whom received extracorporeal membrane oxygenation as rescue therapy. A total of 13 patients received vasopressors, and 2 patients received kidney replacement therapy.

Dynamic Profile of Laboratory Findings in Patients With NCIP

To determine the major clinical features that appeared during NCIP progression, the dynamic changes in 6 clinical laboratory parameters, including hematological and biochemical parameters, were tracked from day 1 to day 19 after the onset of the disease at 2-day intervals. At the end of January 28, 2020, data from 33 patients with complete clinical course were analyzed (Figure 2). During hospitalization, most patients had marked lymphopenia, and nonsurvivors developed more severe lymphopenia over time. White blood cell counts and neutrophil counts were higher in nonsurvivors than those in survivors. The level of D-dimer was higher in nonsurvivors than in survivors. Similarly, as the disease progressed and clinical status deteriorated, the levels of blood urea and creatinine progressively increased before death.

Presumed Hospital-Related Transmission and Infection

Of the 138 patients, 57 (41.3%) were presumed to have been infected in hospital, including 17 patients (12.3%) who were already hospitalized for other reasons and 40 health care workers (29%). Of the hospitalized patients, 7 patients were from the surgical department, 5 were from internal medicine, and 5 were from the oncology department. Of the infected health care workers, 31 (77.5%) worked on general wards, 7 (17.5%) in the emergency department, and 2 (5%) in the ICU. One patient in the current study presented with abdominal symptoms and was admitted to the surgical department. More than 10 health care workers in this department were presumed to have been infected by this patient. Patient-to-patient transmission also was presumed to have occurred, and at least 4 hospitalized patients in the same ward were infected, and all presented with atypical abdominal symptoms. One of the 4 patients had fever and was diagnosed as having nCoV infection during hospitalization. Then, the patient was isolated. Subsequently, the other 3 patients in the same ward had fever, presented with abdominal symptoms, and were diagnosed as having nCoV infection.

Discussion

This report, to our knowledge, is the largest case series to date of hospitalized patients with NCIP. As of February 3, 2020, of the 138 patients included in this study, 26% required ICU care, 34.1% were discharged, 6 died (4.3%), and 61.6% remain hospitalized. For those who were discharged (n = 47), the hospital stay was 10 days (IQR, 7.0-14.0). The time from onset to dyspnea was 5.0 days, 7.0 days to hospital admission, and 8.0 days to ARDS. Common symptoms at onset of illness were fever, dry cough, myalgia, fatigue, dyspnea, and anorexia. However, a significant proportion of patients presented initially with atypical symptoms, such as diarrhea and nausea. Major complications during hospitalization included ARDS, arrhythmia, and shock. Bilateral distribution of patchy shadows and ground glass opacity was a typical hallmark of CT scan for NCIP. Most critical ill patients were older and had more underlying conditions than patients not admitted to the ICU. Most patients required oxygen therapy and a minority of the patients needed invasive ventilation or even extracorporeal membrane oxygenation.

The data in this study suggest rapid person-to-person transmission of 2019-nCoV may have occurred. The main reason is derived from the estimation of the basic reproductive number (R₀) based on a previous study.¹⁵ R₀ indicates how contagious an infectious disease is. As an infection spreads to new people, it reproduces itself; R₀ indicates the average number of additional individuals that one affected case infects during the course of their illness and specifically applies to a population of people who were previously free of infection and have not been vaccinated. Based on the report, R₀ from nCoV is 2.2, which estimated that, on average, each patient has been spreading infection to 2.2 other people.¹⁵ One reason for the rapid spread may be related to the atypical symptoms in the early stage in some patients infected with nCoV.

A recent study showed that nCoV was detected in stool samples of patients with abdominal symptoms.¹⁶ However, it is difficult to differentiate and screen patients with atypical symptoms. Nevertheless, the rapid human-to-human transmission among close contacts is an important feature in nCoV pneumonia.^10,11,15

The patients admitted to the ICU were older and had a greater number of comorbid conditions than those not admitted to the ICU. This suggests that age and comorbidity may be risk factors for poor outcome. However, there was no difference in the proportion of men and women between ICU patients and non-ICU patients. These data differ from the recent report that showed 2019-nCoV infection is more likely to affect males.⁸ The possible explanation is that the nCoV infection in patients in the previous report was related to exposure associated with the Huanan Seafood Wholesale Market, and most of the affected patients were male workers. Compared with symptoms in non-ICU patients, symptoms were more common in critically ill patients, including dyspnea, abdominal pain, and anorexia. The onset of symptoms may help physicians identify the patients with poor prognosis. In this cohort, the overall rates of severe hypoxia and invasive ventilation were higher than those in the previous study,⁹ likely because the cases in the previous study were from the early epidemic stage of the NCIP, and the current cases are from the stage of outbreak.

The most common laboratory abnormalities observed in this study were depressed total lymphocytes, prolonged prothrombin time, and elevated lactate dehydrogenase. Compared with non-ICU patients, patients who received ICU care had numerous laboratory abnormalities. These abnormalities suggest that 2019-nCoV infection may be associated with cellular immune deficiency, coagulation activation, myocardia injury, hepatic injury, and kidney injury. These laboratory abnormalities are similar to those previously observed in patients with MERS-CoV and SARS-CoV infection.

The dynamic profile of laboratory findings was tracked in 33 patients with NCIP (5 nonsurvivors and 28 survivors). In the nonsurvivors, the neutrophil count, D-dimer, blood urea, and creatinine levels continued to increase, and the lymphocyte counts continued to decrease until death occurred. Neutrophilia may be related to cytokine storm induced by virus invasion, coagulation activation could have been related to sustained inflammatory response, and acute kidney injury could have been related to direct effects of the virus, hypoxia, and shock. The 3 pathologic mechanisms may be associated with the death of patients with NCIP.

Until now, no specific treatment has been recommended for coronavirus infection except for meticulous supportive care.¹⁷ Currently, the approach to this disease is to control the source of infection; use of personal protection precaution to reduce the risk of transmission; and early diagnosis, isolation, and supportive treatments for affected patients. Antibacterial agents are ineffective. In addition, no antiviral agents have been found to provide benefit for treating SARS and MERS. All of the patients in this study received antibacterial agents, 90% received antiviral therapy, and 45% received methylprednisolone. The dose of oseltamivir and methylprednisolone varied depending on disease severity. However, no effective outcomes were observed.

This study has several limitations. First, respiratory tract specimens were used to diagnose NCIP through RT-PCR. The serum of patients was not obtained to evaluate the viremia. The viral load is a potentially useful marker associated with disease severity of coronavirus infection, and this should be determined in NCIP. Second, hospital-related transmission/infection could not be definitively proven but was suspected and presumed based on timing and patterns of exposure to infected patients and subsequent development of infection. Third, among the 138 cases, most patients are still hospitalized at the time of manuscript submission. Therefore, it is difficult to assess risk factors for poor outcome, and continued observations of the natural history of the disease are needed.

Conclusions

In this single-center case series of 138 hospitalized patients with confirmed NCIP in Wuhan, China, presumed hospital-related transmission of 2019-nCoV was suspected in 41% of patients, 26% of patients received ICU care, and mortality was 4.3%.

Section Editor: Derek C. Angus, MD, MPH, Associate Editor, JAMA ([email protected]).

Back to top

Article Information

Corresponding Author: Zhiyong Peng, MD, Department of Critical Care Medicine, Zhongnan Hospital of Wuhan University, Wuhan 430071, Hubei, China ([email protected]).

Accepted for Publication: February 3, 2020.

Published Online: February 7, 2020. doi:10.1001/jama.2020.1585

Author Contributions: Drs D. Wang and Peng had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Drs D. Wang and B. Hu contributed equally and share first authorship. Drs Peng and X. Wang contributed equally to this article.

Concept and design: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Acquisition, analysis, or interpretation of data: D. Wang, C. Hu, Zhu, Liu, Zhang, B. Wang, Xiang, Cheng, Xiong, Peng.

Drafting of the manuscript: D. Wang, C. Hu, Xiang, Xiong, Li, Peng.

Critical revision of the manuscript for important intellectual content: D. Wang, B. Hu, Zhu, Liu, Zhang, B. Wang, Cheng, Xiong, Zhao, X. Wang, Peng.

Statistical analysis: C. Hu, Zhu, Liu, B. Wang, Xiong.

Obtained funding: D. Wang, Peng.

Administrative, technical, or material support: B. Hu, Xiang, Cheng, Xiong, Li, X. Wang.

Supervision: B. Hu, Xiong, Zhao, X. Wang, Peng.

Conflict of Interest Disclosures: None reported.

Funding/Support: This work was supported by the National Natural Science Foundation (grant 81701941 to Dr D. Wang; grants 81772046 and 81971816 to Dr Peng) and the Special Project for Significant New Drug Research and Development in the Major National Science and Technology Projects of China (2020ZX09201007 to Dr Peng).

Role of the Funder/Sponsor: The funders had no role in the design and conduct of the study; collection, management, analysis, and interpretation of the data; preparation, review, or approval of the manuscript; and decision to submit the manuscript for publication.

References

1.

Lu  H, Stratton  CW, Tang  YW.  Outbreak of pneumonia of unknown etiology in Wuhan China: the mystery and the miracle  [published January 16, 2020].  J Med Virol. 2020. doi:10.1002/jmv.25678PubMedGoogle Scholar

2.

Hui  DS, I Azhar  E, Madani  TA,  et al.  The continuing 2019-nCoV epidemic threat of novel coronaviruses to global health: the latest 2019 novel coronavirus outbreak in Wuhan, China  [published January 14, 2020].  Int J Infect Dis. 2020;91:264-266. doi:10.1016/j.ijid.2020.01.009PubMedGoogle ScholarCrossref

3.

Wuhan Municipal Health Commission. Report of novel coronavirus-infected pneumonia in China. Published January 20, 2020. Accessed January 31, 2020. http://wjw.wuhan.gov.cn/front/web/showDetail/2020012009077

4.

Paules  CI, Marston  HD, Fauci  AS.  Coronavirus infections—more than just the common cold  [published January 23, 2020].  JAMA. doi:10.1001/jama.2020.0757
ArticleGoogle Scholar

5.

Wuhan Municipal Health Commission. Report of clustering pneumonia of unknown etiology in Wuhan City. Published December 31, 2019. Accessed January 31, 2020. http://wjw.wuhan.gov.cn/front/web/showDetail/2019123108989

6.

World Health Organization. Novel coronavirus(2019-nCoV): situation report—15. Accessed February 5, 2020. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200204-sitrep-15-ncov.pdf

7.

Zhu  N, Zhang  D, Wang  W,  et al; China Novel Coronavirus Investigating and Research Team.  A novel coronavirus from patients with pneumonia in China, 2019  [published January 24, 2020].  N Engl J Med. doi:10.1056/NEJMoa2001017PubMedGoogle Scholar

8.

Chen  N, Zhou  M, Dong  X,  et al.  Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study  [published January 29, 2020].  Lancet. doi:10.1016/S0140-6736(20)30211-7PubMedGoogle Scholar

9.

Huang  C, Wang  Y, Li  X,  et al.  Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China  [published January 24, 2020].  Lancet. doi:10.1016/S0140-6736(20)30183-5PubMedGoogle Scholar

10.

Chan  JF-W, Yuan  S, Kok  K-H,  et al.  A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster  [published January 24, 2020].  Lancet. 2020;S0140-6736(20)30154-9. doi:10.1016/S0140-6736(20)30154-9PubMedGoogle Scholar

11.

Phan  LT, Nguyen  TV, Luong  QC,  et al.  Importation and human-to-human transmission of a novel coronavirus in Vietnam  [published January 28, 2020].  N Engl J Med. doi:10.1056/NEJMc2001272PubMedGoogle Scholar

12.

World Health Organization. Clinical management of severe acute respiratory infection when novel coronavirus (nCoV) infection is suspected: interim guidance. Published January 28, 2020. Accessed January 31, 2020. https://www.who.int/publications-detail/clinical-management-of-severe-acute-respiratory-infection-when-novel-coronavirus-(ncov)-infection-is-suspected

13.

Ranieri  VM, Rubenfeld  GD, Thompson  BT,  et al; ARDS Definition Task Force.  Acute respiratory distress syndrome: the Berlin definition.  JAMA. 2012;307(23):2526-2533. doi:10.1001/jama.2012.5669
ArticlePubMedGoogle Scholar

14.

Kidney Disease: Improving Global Outcomes (KDIGO) Acute Kidney Injury Work Group.  KDIGO Clinical Practice Guideline for Acute Kidney Injury.  Kidney Int Suppl. 2012;2:1.Google ScholarCrossref

15.

Li  Q, Guan  X, Wu  P,  et al.  early transmission dynamics in Wuhan, China, of novel coronavirus-infected pneumonia.  [published on January 29, 2020].  N Engl J Med. 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar

16.

Zhang  H, Kang  ZJ, Gong  HY,  et al.  The digestive system is a potential route of 2019 nCoV infection: a bioinformatics analysis based on single-cell transcriptomes.  Preprint. Posted online January 31, 2020. bioRxiv 927806. doi:10.1101/2020.01.30.927806

17.

de Wit  E, van Doremalen  N, Falzarano  D, Munster  VJ.  SARS and MERS: recent insights into emerging coronaviruses.  Nat Rev Microbiol. 2016;14(8):523-534. doi:10.1038/nrmicro.2016.81PubMedGoogle ScholarCrossref

https://jamanetwork.com/journals/jama/fullarticle/2761044

 

Overlevende fra SARS er veldig oppskremt av Coronavirus. Video er ikke eldre enn 7. februar 2020. Han mener selv at boligblokkas kloakksystem, eller kanskje det var rørsystem generellt han mente som han tror er en synder til den SARS-spredning han selv opplevde der han bodde:

 

Her en dame som tross alder og helsetilstand fikk lykketreff og overlevde det:

Quote

Jaimuay Sae-ung, who developed pneumonia, was the first Thai national to catch the deadly virus. She has defied the ‘one-in-a-million’ odds to survive her battle with the coronavirus

https://www.dailymail.co.uk/health/article-7969059/Elderly-Thai-woman-73-survives-battle-coronavirus.html

 

Her får dere et innblikk i hvilken type tiltak som ble iverksatt for denne unge kineseren.

Obs!! Han var første pasient i sin by. Og opplevde nok ikke et kollaps av et helsevesen slik som muligens Wuhan opplever/opplevde i starten/eller videre:

Quote

Mr Li was the first patient diagnosed as part of the viral outbreak in Jingzhou City – about a 3-hour drive from Wuhan – in Hubei Province.

Quote

4 stages of infection, recovery took 16 days

Mr Li was made to undergo the following tests while warded in the hospital:

• Blood tests
• Chest radiography
• Ultrasound tests

In the first phase of treatment, he shares that personal nutrition was key in ensuring that his body’s immune system was fit to combat the virus.

Mr Li claims that eating regularly & well, even if one has no appetite, reduces the risk of losing your immunity & resistance.

High fever of 38-40°C for up to 4 days

The second stage – which lasts 3-4 days – involves a high fever anywhere from 38-40°C through the night.

Source

 

Mr Li spoke carefully about being mentally prepared & always having faith in your own immune system’s ability to combat the virus — a true battle of mind over body.

Once patients last through Stage 2 – arguably the most challenging phase of the viral infection – their bodies will naturally “get stronger” and begin fighting the virus.

Surviving the battle of mind over body

This brings us to Stage 3 — aka recovery. In this stage, Mr Li shares that doctors will prescribe medicine depending on each patient’s remaining symptoms.

Following the doctor’s orders & recommendations closely is key at this stage of the infection.

Doctors will typically keep patients under close observation as the body does the rest of the healing, until the final stage is complete.

A “nucleic acid test” will then be conducted, and if the patient tests negative, they’ll be allowed to return home.

https://mustsharenews.com/wuhan-virus-survivor/

Er video i artikkel-lenken ovenfor, eller på Facebook her:

https://www.facebook.com/sixthtone/videos/534836760460192/

 

Han så veldig sliten ut. Det kunne kanskje virke litt tillagt ut og at han kanskje leste innøvd og opplest manuskript. Er min følelse. Men det er jo viktig med positive nyheter også, så..

Endret 10. februar 2020 av G

[G]

Frykter koronaviruset i kontorlandskap

Artikkel hos Karriere360 en del av Tu-media: https://karriere360.no/artikler/frykter-koronaviruset-i-kontorlandskap/484820

Quote

Kontorlandskap øker smittefaren

Fersk norsk forskning viser at folk som på ulike måter sitter sammen med andre folk når de jobber, enten i kontorlandskap eller på delt kontor, har større risiko for å bli syke.

Koronaviruset smitter ifølge Folkehelseinstituttet mest sannsynlig gjennom dråpe- og kontaktsmitte. Trolig tar det minst to dager, kanskje opptil to uker, fra smitten inntreffer til symptomene er merkbare.

Illustrasjonsbilde fra Shanghai Stock Exchange

Endret 10. februar 2020 av G

[G]

China virus cases rise again; UK to detain those infected

https://edition.cnn.com/videos/world/2020/02/08/day-in-wuhan-china-david-culver-pkg-vpx.cnn

https://www.kfyrtv.com/content/news/China-virus-cases-rise-again-UK-to-detain-those-infected-567722541.html

Quote

BEIJING (AP) - China is reporting a rise in new virus cases, denting optimism that disease control measures which isolated major cities might be working.

A woman wearing face mask walks past empty shelf of tissue papers at supermarket in Hong Kong, Thursday, Feb. 6, 2020. (Source: AP Photo/Vincent Yu)

China’s health ministry said another 3,062 cases had been reported over the previous 24 hours, raising the Chinese mainland’s total to 40,171. The mainland death toll has risen by 97 to 908.

Monday’s rise was a turnaround from a significant reduction in new cases reported Sunday that briefly prompted optimism prevention methods such as strict quarantines may be working.

An infection specialist who worked on the earlier outbreak of SARS says “dramatic reductions” in the pace of the disease’s spread should begin this month if containment works.

Also on Monday, Britain declared the virus a "serious and imminent threat to public health'' and announced new measures to combat the spread of the disease.

The U.K. Department of Health and Social Care said people with the virus can now be forcibly quarantined. It named two British hospitals as isolation facilities for those affected and designated the Chinese city of Wuhan and the surrounding Hubei province as an “infected area.”

 

The change comes after a British man who caught the virus at a business conference in Asia appears to be linked to at least seven other confirmed cases in Europe.

Health ministers from the European Union’s 27 nations will hold an emergency meeting Thursday on the virus.

Meanwhile, Japan is reporting dozens of new cases aboard a quarantined cruise ship. The operator of the Diamond Princess cruise ship, quarantined near Tokyo, says health officials found 66 new cases on board in addition to 70 found earlier.

More than 3,600 people are still in a 14-day quarantine on board the ship.

Copyright 2020 Associated Press. All rights reserved.

 

 

Og her er litt om hvordan befolkningen i Wuhan opplever det hele. Ikke særlig oppløftende:

 

En veldig interessant vinkling nå med myndighetene i Kinas øyne på det hele. Når myndighetene også virker lettere desperate, eller ihvertfall kvass i tonen:

Quote

Increasingly desperate officials in the quarantined epicentre of the coronavirus outbreak have tightened controls on an already frightened population, likening the growing crisis to “wartime conditions”.

Authorities in Wuhan city have started going door to door checking temperatures, and rounding up suspected coronavirus patients for forcible quarantine in stadiums and exhibition centres that are serving as warehouses for the sick, the New York Times reported. The city and country face “wartime conditions”, the paper quoted vice-premier Sun Chunlan, who has been put in charge of the national campaign against the virus, as saying on a visit to Wuhan. She said: “There must be no deserters, or they will be nailed to the pillar of historical shame forever.”

https://www.theguardian.com/world/2020/feb/07/wuhan-facing-wartime-conditions-as-china-tries-to-contain-coronavirus

Litt basketak på folk som motvillig lot seg sette i karantene:

 

100 millioner mennesker er spådd å bli smittet ved enden av februar (om ca. 20 dager). Aner ikke, men det var da harde tall:

 

Stakkars cruiseshippassasjerer. Må vel være verste stedet man kan være på vel?

 

Spesiellt - vel vitende om at (husket feil der) kriminalitet blir henlagt ombord de kan finne på å dumpe liket ditt på havet, og du har lite rettigheter 

 

Endret 10. februar 2020 av G

[Gjest Slettet+5132]

Rapport fra Imperial College London estimerer dødsraten for  Hubei til å være rundt 18%, mens globalt til å ligge på rundt 1%, og de presiserer

Quote

It is important to note that the differences in these estimates does not reflect underlying differences in disease severity between countries. CFRs seen in individual countries will vary depending on the sensitivity of different surveillance systems to detect cases of differing levels of severity and the clinical care offered to severely ill cases.

I Hubei overvåker eller tester de altså neppe folk med symptomer mildere enn lungebetennelse, og dødeligheten blir dermed noe høy. Utenfor Kina blir man testet bare man har sett på flypriser til Kina, og man har derfor større sjanse til å fange opp alle pasienter, også de svært milde.